The upregulation of syndecan-4 is induced by Pax5, as multipotent CLP-like pro-/pre-B cells commit themselves to B-cell differentiation [18, 30]. Syndecan-4 is also expressed on stromal cells located in fetal liver and BM in the proximity of these proB and preBCR+pre-B cells [31]. More specifically, syndecan-4 could interact with the non-Ig portion of the lambda5-component of it [32]. Furthermore, pre-B cells and stromal cells could learn more also establish contacts by mutual interactions of their heparin-sulfate side-chains of syndecan-4 with other heparin-sulfate-containing proteoglycans on the opposite types of cells.

We hypothesize that a miR-221-induced reduction in the surface expression of syndecan-4, as seen by us, could contribute to a change in quantity, thus also quality of its interactions with F-actin-filaments and, consequently, favor the residence of miR-221-expressing cells in the multipotent CLP/like pro//pre-B-cell niches. It remains a formidable challenge to understand how the 25 genes that we reduced in their expression by miR-221 can lead to a changed migration

to, and residence in BM. If this activity of miR-221 GS-1101 price has comparable functional consequences for pHSCs and MPPs, also of humans, overexpression of this miRNA might improve the migration and residence also of these cells and, thereby, improve efficiencies of BM transplantations, also in clinical settings. C57BL/6 (CD45.1) and Rag1−/− (CD45.2) mice were bred in the laboratory animal facility of the Max-Planck-Institute under SPF conditions. miRNAs were induced in vivo feeding mice continuously, in half-weekly changes, with drinking water containing 0.2 g/L doxycycline and 50 g/L sucrose at pH 3.0. All of the experimental procedures Amine dehydrogenase complied with “National Regulations for the Care and Use

of Laboratory Animals” (protocol G0099/08 approved by the Landesamt für Gesundheit und Soziales, Berlin). Pre-B-I cells derived from WT fetal liver (C57BL/6, CD45.1+) at day 18 of gestation and Pax5−/− pro-/pre-B cells were grown as described before [15]. The stromal cell line OP9 and OP9Δl-1 were kindly given to us by Dr. Zuniga-Pfluecker (University of Toronto, Canada). Cytokine supernatants were produced using the hybridoma cell lines J558L/IL-7 and Sp2.0-Flt3L (a kind gift of Dr. Paulo Vieira, Institute Pasteur, Paris, France). In vitro differentiation experiments were done as described [33]. Cells were harvested and analyzed by flow cytometry 3 days after incubation. MiR-221 and miR-222 were cloned into the vector pSM30-EGFP [22] by cutting the vector with BsmB-I and annealing the oligos, which contained the mature miRNAs (see Supporting Information Fig. 2A). The top oligo sequences were: miR-221: AGCGCGCTACATTGTCTGCTGGGTTTCTAGTGAAGCCACAGATGTAGAAACCCAGCAGACAATGTAGCT; miR-222: AGCGCGCTACATCTGGCTACTGGGTTAGTGAAGCCACAGATGTAACCCAGTAGCCAGATGTAGCT.

[6] Kawano et al. proposed diagnostic criteria for IgG4-RKD that included Staurosporine datasheet histological findings in the kidney, the presence of plasma cell-rich TIN with >10 IgG4-positive plasma cells/hpf or ratio of IgG4/IgG-positive plasma cells >40% and characteristic ‘storiform’ fibrosis surrounding nests of lymphocytes or plasma cells. It was shown that 95% of cases of IgG4-RKD could be diagnosed accurately using these criteria.[5] However, the definitive diagnosis of IgG4-RKD is not necessarily easy, and at times it is difficult to differentiate IgG4-RKD

from lymphoproliferative disorders or Castleman disease.[7] In the present case, the patient had findings that corresponded to the diagnostic criteria, such as a buy Doxorubicin high level of serum IgG4, a non-enhanced mass at the renal hilum and contrast defect areas in the renal cortex of the graft on a CT scan, and dense IgG4-positive plasma cell infiltration in the interstitium on a renal biopsy. However, she had some atypical

clinical features. First, ‘storiform’ fibrosis surrounding plasma cells was not observed. Yoshita et al. showed that ‘storiform’ fibrosis was present in 92% of cases of IgG-RKD.[8] Second, she had no other organ involvement. Saeki et al. showed 96% of patients with IgG4-RKD had involvement of other organs.[9] Third, increasing doses of steroid did not reduce the serum creatinine

level despite histological improvement. Fourth, the predominance of kappa-type light-chain positive plasma cells amongst the infiltrating Lck cells suggested the presence of a post-transplant lymphoproliferative disorder (PTLD). However, the absence of M protein following immunofixation and normal serum levels of κ and λ free light chains and κ/λ ratio were not consistent with a diagnosis of PTLD. However, cases of ocular adnexal mucosa-associated lymphoid tissue (MALT) lymphoma mixed with IgG4-RD have recently been reported.[10, 11] Takahashi et al.[12] also reported three cases of non-Hodgkin lymphoma that developed three to 5 years after diagnosis of IgG4-RD in 111 patients. This finding suggested patients with IgG4-RD may have an increased risk of non-Hodgkin lymphoma, and therefore careful follow-up is needed in this patient population. On the other hand, the diagnosis of IgG4-RD is more confusing in the transplant setting. Castillo et al. showed that in liver transplant recipients receiving heavy immunosuppression, IgG4 positivity was not synonymous with IgG4-RD, making it difficult to distinguish between the two groups.[13] Regarding the treatment for IgG4-RKD, although no randomized trials have evaluated the treatment of IgG4-RKD, about 90% of patients respond to glucocorticoids.

2C) 5, but was completely absent on retinal inflammatory macrophages in peak stage EAU; remarkably, CRIg expression on macrophage returned and in increase amounts in the resolving stages of EAU (Fig. 2F). Whether this change in expression was due to reprogramming of resident macrophages or represented de novo recruitment EPZ 6438 of macrophages at different stages of disease is unclear. What

is clear is that CRIg+ macrophages may belong to the “suppressive” variety of macrophage and may play important roles in tissue homeostasis. They may also be involved in the resolution of inflammation probably by promoting the clearance of apoptotic cells 21, 23. One of the homeostatic roles of the choroidal CRIg+ macrophage might be to prevent tissue overt complement activation. When the tissue is inflamed (such as in EAU), tissue-resident CRIg+ macrophages are quickly consumed or negatively regulated

by inflammatory cytokines, and the newly recruited macrophages do selleck screening library not express CRIg. The lack of CRIg molecules allows complement activation proceeding uncontrolled in EAU. When exogenously administering the soluble form of CRIg i.e. CRIg-FC, complement activation is blocked resulting in reduced C3a/C5a production, which may indirectly affect inflammatory cytokine production. It is also possible that CRIg-Fc may inhibit pro-inflammatory CRIg− macrophages and suppress NO, TNF-α, and other mediators including complement components (such

as CFB) production. The effect of CRIg-Fc on Th1/Th17 cytokine production observed in this study may be indirectly resulted from the suppression of the pro-inflammatory macrophage activation, or C5a production (as a result of reduced complement activation). Further mechanistic studies on the suppressive effect of CRIg-Fc on macrophages and dendritic cells, the possible unknown receptors for CRIg-Fc, and the signalling pathways will be important to understand the immune regulation roles of CRIg and such experiments are undergoing in the investigators’ laboratory. In summary, in this study we show that the AP complement activation plays detrimental roles in retinal pathology. Blocking AP-mediated complement activation with CRIg-Fc reduces retinal inflammation. CRIg-Fc not only selectively blocks the AP complement activation, but also suppresses inflammatory macrophage function and reduces crotamiton disease severity in EAU. CRIg-Fc could be a good candidate for uveitis therapy. Female C57BL/6 mice, 8- to 12-wk old, 18–24 g, were supplied by the Medical Research Facility of the University of Aberdeen (Scotland, UK). All animals were managed in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research (Rockville, MI) and under the Home Office Regulations for Animal Experimentation (UK). The animal work was approved by the Ethic Committee of the University of Aberdeen.

The mice received a four-collagen–antibodies cocktail intravenously (i.v.) 10 days later (20 days after surgery, day 0). One week later, they received an intraperitoneal (i.p.) injection of LPS to enhance arthritis incidence and severity, and the experiment was terminated on day 14. Control

mice were injected with phosphate-buffered saline (PBS) i.v. and LPS i.p. Male transgenic ERE-luciferase mice were castrated and 11 days later immunized with chicken CII and adjuvant. After 9 days they received one subcutaneous injection of raloxifene, oestradiol or vehicle, and were then terminated 10 h later (day 10 after immunization). Mice were given subcutaneous injections 5 days per week of the raloxifene analogue LY117018 (generous gift from Eli Lilly, Indianapolis, Selleck Small molecule library IN, USA) (60 µg/mouse/day) or 17β-oestradiol-3-benzoate (E2) (Sigma, St Louis, MO, USA) (1·0 µg/mouse/day)

dissolved in Miglyol812 (OmyaPeralta GmbH, Hamburg, Germany). Control mice received Miglyol812 (100 µl/mouse/day). The dosages of Ral and E2 have been shown previously to prevent osteoporosis equally well in mice [19–21]. LY117018 differs from raloxifene at only one site on the molecule, with a pyrrolidine ring on the basic side chain instead of a piperidine ring. This small difference does not affect its biological properties. Thus, INCB024360 mouse Ral and LY117018 can be regarded as replaceable with respect to their biological properties. Experiment 1.  Two weeks after ovariectomy DBA/1 mice were immunized with 100 µg of chicken CII (Sigma, St Louis, MO, USA) dissolved in 0·1 m acetic acid and emulsified with an equal volume of incomplete Freund’s adjuvant (Sigma) supplemented with 0·5 mg/ml Mycobacterium tuberculosis (Sigma). A total volume of 100 µl was injected intradermally at the base of the tail. After 21 days, mice received next a booster injection with CII emulsified in incomplete Freund’s adjuvant. Arthritis developed shortly thereafter, and was evaluated continuously for frequency and

severity. Experiment 2.  Twenty days after OVX or sham-operation, DBA/1 mice received an intravenous shot of a four-antibody cocktail [monoclonal immunoglobulin (Ig)G antibodies specific for the C1, J1, D3 and U1 epitopes on the collagen type II molecule], according to the protocol of Nandakumar and Holmdahl [10]. Non-arthritic controls received equal volumes of PBS. One week later, all mice received an intraperitoneal injection of 25 µg LPS (Escherichia coli 055 : B5; Difco Laboratories, Detroit, MI, USA). Experiment 3.  ERE-luciferase mice were immunized with 100 µg of chicken CII (Sigma) dissolved in 0·1 m acetic acid and emulsified with an equal volume of incomplete Freund’s adjuvant (Sigma) supplemented with 0·5 mg/ml M. tuberculosis (Sigma). A total volume of 100 µl was injected intradermally at the base of the tail.

albicans (Fig. 5). The structural and bioimmunological analysis of Candida mannans has mostly been conducted using yeast cells form grown at 28 °C. Nevertheless, Candida cells become pathogenic and invade tissue in the hyphal form at 37 °C [30, 31]. Recently, it has been shown that presence of the α-1,6-linked branching

mannose residues in mannan structure is reduced in Candida hyphal form mannan [8]. IgM and IgG antibodies levels induced by both conjugates immunization were slightly higher for hyphal morphological form of C. albicans (Fig. 5). Difference in α-1,6-linked branching presence in mannan of C. albicans yeast and hyphal form and detected antibody levels indicate that recognized antigenic determinants are α-1,6-linked branching independent. signaling pathway We can suppose that observed difference in induction of humoral immune response by M5-BSA and M6-BSA conjugates is less related to difference in oligomannoside length and is more related to structure diversity,

concretely branching difference at non-reducing end of oligomers. Generally, oligosaccharides of intermediate length are required for the carbohydrate components of conjugate vaccines to obtain conformation similar to click here its native state on the cell surface. In the case of β-1,2-linked mannooligomers, the size of the epitopes that are able to induce protective antibodies is 2 or 3 residues [1]. We can suppose that dominant antigenic determinants of α-1,6-branched oligomannosides are not related

to branching site. In addition, whole cell ELISA assay reveal marked non-specific interaction of serum antibodies with Candida whole cells of both morphological forms. Determination of the source of non-specific interactions requires further investigation. IgGl and IgG2a subclass antibodies play a significant role in the opsonization either in the presence or absence of complement [32]. A comparison of the levels of IgGl and IgG2a indicates poor correlation between the putative Th responses Astemizole initiated and mice strain susceptibility to infection [33]. Experimental infection of BALB/c mice with low susceptibility to Candida infection produced increased levels of IgGl instead of IgG2a [33]. By immunization with semi-synthetic oligomannoside-BSA conjugates M5-BSA and M6-BSA, we observed in agreement with mentioned report increase in IgG1 levels instead of IgG2a. The ability of immune sera to enhance the candidacidal activity of PMN was studied according to previously published candidacidal assay [14]. The published observations of efficient yeast cells opsonophagocytosis revealed ability of mannan-specific antibodies alone to serve as sufficient opsonins [34]. These results are supported by an earlier report of C. albicans yeast cells opsonophagocytic killing by human neutrophils induced by natural anti-mannan antibodies [35].

Conclusion:  We conclude that HD patients were at an increased risk for both ischaemic and haemorrhagic stroke compared with

the general population. “
“Aim:  Renal dysfunction is an independent risk factor for cardiovascular events. However, little is known regarding FK506 the impacts of renal dysfunction on coronary atherosclerosis. Methods:  The effects of 8-month statin therapy on coronary atherosclerosis were evaluated in the TRUTH study using virtual histology intravascular ultrasound in 164 patients with angina pectoris. We analyzed correlations between the estimated glomerular filtration rate (eGFR) and coronary atherosclerosis before and during statin therapy. Results:  Baseline eGFR was 64.5 mL/min per 1.73 m2. Serum low-density lipoprotein cholesterol level decreased significantly from 132 to 85 mg/dL (−35%, P < 0.0001) after 8 months. Weak, but significant, negative correlations were observed between eGFR and external elastic membrane volume (r = −0.228, P = 0.01) and atheroma volume (r = −0.232, P = 0.01) at baseline. The eGFR was also negatively correlated with fibro-fatty volume (r = −0.254, P = 0.005) and fibrous volume (r = −0.241, P = 0.008) at baseline. Multivariate regression analyses showed

that eGFR was a significant independent predictor associated with statin pre-treatment volume in fibro-fatty (β = −0.23, P = 0.01) and fibrous (β = −0.203, P = 0.02) components. Furthermore, eGFR was positively correlated with volume change in the fibro-fatty BYL719 chemical structure component during statin therapy (r = 0.215, P = 0.02). Conclusion:  Decreased eGFR is associated with expanding remodelling and a greater atheroma volume, particularly the fibro-fatty and fibrous volume before statin therapy in patients with normal to mild renal dysfunction. Reduction of fibro-fatty volume during statin therapy gradually accelerated with decreasing renal function. “
“There is growing interest worldwide in the

beneficial effects of increasing the frequency and/or time of haemodialysis (HD) sessions. Alternative HD regimens to incorporate these changes, also called ‘quotidian’ HD schedules, likely offer advantages over conventional thrice-weekly PDK4 HD. Alternative regimens include short-daily HD (typically performed 1.5–3 h, 5–7 days per week) and nocturnal HD (typically 6–8 h, 3–7 nights per week). Both regimens can be performed at home or in the hospital setting, although in Australia and New Zealand the predominant alternative regimen is nocturnal HD at home. Dialysis prescriptions for alternative schedules vary in many aspects when compared with conventional HD and this review describes differences in dialysate concentrations, blood and dialysate flow rates, ultrafiltration rates, vascular access issues and adequacy of HD between the different HD modalities.

17 Ofsthun et al. reported a similar analysis of 44 550 prevalent haemodialysis patients from the Fresenius Medical this website Care database.18 The relative risk of death for haemoglobin <90 g/L was 2.11 (P < 0.001) compared with a reference haemoglobin level of 110–120 g/L. The relative risk of death decreased to approximately 1.6 and

1.3 as haemoglobin increased to 90–100 g/L and 100–110 g/L, respectively. There was a 16% reduction in mortality for haemoglobin levels between 120 and 130 g/L (RR 0.84, P = 0.007). Fort et al. prospectively studied the effects of time-dependent haemoglobin and ESA dose on mortality in 2310 incident haemodialysis patients from Spain.19 Using a time-dependent multivariate Cox proportional hazard model, the adjusted HR for death was 1.36 (95% CI 1.01–1.86) for a haemoglobin level <100 g/L compared with a level of 111–120 g/L. In contrast, a haemoglobin

level of >130 g/L was associated with a survival benefit (HR 0.69, 95% CI 0.49–0.97). Analysis of the UK Renal Registry data reported similar outcomes with HRs for death for haemoglobin values <100 g/L and >110 g/L being 1.28 (P < 0.001) and 0.64 (P < 0.001), respectively, compared NVP-BKM120 manufacturer with a reference haemoglobin level of 100–110 g/L.20 The HRs decreased as achieved haemoglobin increased (Hb 110–120 g/L HR 0.63; Hb 120–130 g/L HR 0.47, and Hb >130 g/L HR 0.44). Zhang et al. conducted a retrospective study of 94 569 prevalent patients who were on haemodialysis in 2000 and 2001.21 The patients were divided into quartiles of ESA dose (1388–7905 U/week, 7905–13 377 U/week, 13 377–22 068 U/week and >22 068 U/week) and five categories of

haematocrit values (<30%, 30–33%, 33–36%, 36–39% and >39%). Mortality rates decreased as haematocrit values increased. Within each haematocrit category, mortality rates were lowest in the lowest quartile of ESA dose and highest in the highest quartile. A US Medicare study reported outcomes of 393 967 prevalent haemodialysis patients from 2002 to 2004.22 In a fully adjusted Cox proportional hazard model, mortality was higher at all haematocrit levels Org 27569 below 34.5% compared with the reference haematocrit level of 34.5% to 36%. The HR for death increased from 1.17 (95% CI 1.14–1.20) to 3.11 (95% CI 3.01–3.20) when haematocrit decreased from 33–34.5% to <27%. Similarly, mortality increased at all levels of haematocrit >39%. Mortality was comparable for haematocrit levels between 36% and 39%. When patients were grouped into five categories of erythropoietin dose (0 U/week, 0–6000 U/week, 6000–12 000 U/week, 12 000–18 000 U/week and >18 000 U/week), the HR for death progressively increased with increasing dose of erythropoietin for every level of haematocrit.

68, p < .001; χ2[1] = 5.97, p < .05; χ2[1] = 10.51, p < .001, respectively) and an additional linear effect (β1) for language (χ2[1] = 7.25, p < .001). As shown in Figure 4, proportional durations for both affect and action were very low at the beginning, then increased to a peak at 18 months (70 weeks), and finally decreased slowly, in both cases showing an inverted U-shaped trajectory. Language was almost absent in the first weeks and accelerated nonlinearly between https://www.selleckchem.com/products/AZD6244.html the 14th and 18th months, crossing the affect curve after the 18th month and the action curve at the 21st month; then it continued to increase very steeply until the end. Therefore, mother–infant symmetrical

coregulation advanced in the second year of life from nonverbal to verbal form, as hypothesized. An unexpected result, however, was that affect and action exchanges evolved through inverted U-shaped trajectories, suggesting a transitional role played by both frames from unilateral to language. Both action and language patterns were significantly affected by gender (χ2[1] = 8.20, p < .01; χ2[1] = 12.92, p < .01, respectively), with boys being lower in action and higher

in language than girls. For language patterns, however, this effect was qualified by the interaction effect between gender and time (χ2[1] = 11.80, p < .01). As revealed by the simple slopes analysis (Bauer & Curran, 2005; Cohen, Cohen, West, & Aiken, 2003), girls exhibited a significant increase in language proportional durations as a function of time (β = .0002 [.0000], z = 6.33, p < .001), whereas this relation was not significant for boys (β = .0001 PDE inhibitor [.0001]; z = 1.27; NS). Actually, we found that at the beginning of the observational period boys were higher in proportional durations of language, but toward the end they were outperformed by girls. Group data analysis showed that symmetrical

and language coregulation followed a similar trend, although displaced over time with from the first increasing earlier and the second later in development. Therefore, to shed light on the possible relationship between the two coregulation forms, the interaction effect of linear age by symmetrical pattern was added to the language model (Table 2). The inclusion of this term significantly improved the statistical fit (χ2[2] = 116.41, p < .01) of the new model with respect to the previous one. Moreover, the interaction effect was significant (χ2[1] = 144.46, p < .001; χ2[1] = 97.07, p < .001, respectively). Therefore, an increment in proportional durations of symmetrical predicted significantly an increment in proportional duration of language. As in Figure 5, the simple slopes analysis (Bauer & Curran, 2005; Cohen et al., 2003) showed that dyads who were faster (i.e., 1 SD above the average) in symmetrical proportional durations exhibited higher language proportional durations as a function of time (β = .0058 [.0011], z = 5.06, p < .01), whereas this relation was nonsignificant for the slower dyads (i.e.

We would like to thank Professor Nick Willcox for critical reading of the manuscript. G.K. is supported buy RO4929097 by a grant from the FMHS, UAEU. U.C.M. and G.G. are supported by Aims2Cure, Roan Charitable Trust. G.G. holds a grant from the MRC. J. Tzartos and G. Khan report no disclosure. U.-C. Meier has received research support from British Technology Group. G. Giovannoni has received consulting fees from Bayer-Schering Healthcare, Biogen-Idec, Fiveprime therapeutics, GlaxoSmithKline, Ironwood Pharmaceuticals, Merck-Serono, Novartis, Protein Discovery Laboratories, Teva-Aventis, UCB Pharma and Vertex; lecture fees from Bayer-Schering Healthcare, Biogen Idec, and Teva-Aventis;

and grant support from Bayer-Schering Healthcare,

Biogen-Idec, Merck-Serono, Merz, Novartis, Teva-Aventis, and UCB Pharma. “
“Costimulation is a fundamental principle of T-cell activation. In addition to T-cell receptor engagement, the interaction between CD80 and/or CD86 with CD28 and/or cytotoxic T-lymphocyte antigen 4 (CTLA-4) receptors is required to regulate T-cell activation and tolerance. While the importance of costimulation is clearly established, the exact molecular mechanism is unknown. We demonstrate that T-cell proliferation and the ability of CD8+ T-effector cells to kill were enhanced slightly by CD80 but dramatically by CD86 costimulation. To further analyse the cellular process of costimulation, we developed a single-cell assay to analyse Ca2+ signals following costimulation with bi-specific antibodies. check details We found that this stimulation method worked in every human T-cell that was analysed, Atorvastatin making it one of the most efficient T-cell activation methods to date for primary human T cells. The enhanced proliferation and killing by costimulation was paralleled by an increase of Ca2+ influx following CD86 costimulation and it was dependent on CD28/CTLA-4 expression. The enhanced Ca2+ influx following CD86 costimulation

was abrogated by an antibody that interfered with CD28 function. The differences in Ca2+ influx between CD80 and CD86 costimulation were not dependent on the depletion of Ca2+ stores but were eliminated by the application of 10 μm 2-aminoethyldiphenyl borate which has recently been shown to enhance stromal interaction molecule 2 (STIM2)-dependent Ca2+ entry while reducing STIM1-dependent Ca2+ entry. Our data indicate that differences in the efficiency of costimulation are linked to differences in Ca2+ entry. The T cells represent the cornerstone of the cellular human immune system and when adequately activated can eliminate virus-infected or even malignantly transformed cells very efficiently. The activation process of resting T cells to become potent effector cells is complex and requires multiple receptor–ligand interactions. Activation of T cells is initiated through the interaction of T cells and antigen-presenting cells.

It is important that only studies matching the inclusion criteria are included in the systematic review, so that the systematic review answers a specific clinical question. Prospective criteria for study inclusion and exclusion should be explicitly BMS-777607 molecular weight stated in the review to minimize selectivity by authors. These criteria are a requirement before commencing Cochrane reviews, when a study protocol is developed, peer reviewed and published before initiating the review. The decision regarding which studies to include in a systematic review may have an important effect on a conclusion, say regarding the overall utility

of a healthcare intervention.13 Therefore, study inclusion assessment should be completed independently by at least two authors and generally is arbitrated by a third. Readers of systematic reviews can look for a flow chart (usually presented as a Fig. 1) describing the details of studies identified, studies excluded, reasons for exclusion and numbers of studies included in the final review. If the outcome of interest is dichotomous (the outcome

is one of two possibilities – example, death or survival) the treatment effect is calculated for each trial as a risk ratio, an odds ratio or a risk difference together with the 95% confidence interval (95% CI; the range AZD1208 supplier within which we are 95% confident that the effect calculated is likely to exist). While full discussion of all methods Liothyronine Sodium is beyond the scope of this review, dichotomous outcomes are frequently evaluated as a relative risk (RR), which deserves a brief explanation. A RR divides the event rate in the intervention group (number of events divided by the total number of individuals randomized in that group) by the event rate in the comparison group. For example, if 20 of 100 patients in the active intervention group who are randomized to

erythropoietin to normalize haemoglobin levels experienced an event and 10 of 100 patients in the control group (those randomized to a lower haemoglobin target), experienced the event, then the RR is 2 (20/100 divided by 10/100), indicating that the intervention is twice more likely than the comparison treatment to result in the outcome. Interpretation of this risk for the specific patient is possible when the actual risk of the outcome for that patient without treatment is known (e.g. when RR = 2, a doubling of risk from 2% to 4% is quite different from the doubling of risk from 10% to 20% in the present example). If the outcome of interest is a continuous variable (an example is systolic blood pressure, mmHg), then the effect size of the intervention is summarized as a mean difference (MD; and its 95% CI). The MD for the outcome in each trial is the amount by which an intervention changes the outcome on average compared with the control.